eddb.info

Dariusz W. Szczepanik

K. Guminski Department of Theoretical Chemistry
Faculty of Chemistry, Jagiellonian University
Gronostajowa 2, 30-387 Krakow, Poland
(048) 12 686 23 90
dariusz.szczepanik@uj.edu.pl



PL  What is RunEDDB?

The RunEDDB program imlements the recently proposed method of the one-electron density ED(r) decomposition into components representing different levels of electron delocalization:

This novel charge decomposition scheme utilizes the recently proposed bond-orbital projection formalism, which is partially based on the age-old concept of bond-order orbitals and as such it is well defined for one-determinant wavefunctions (HF- and DFT-type) of both closed- and open-shell molecular systems. Its current implementation involves the Hilbert-space partitioning within the representation of natural atomic orbitals (NAO), which is widely available for most of the popular quantum-chemistry packages through NBO and JaNPA interfaces.

PL  Features & Capabilities

The EDLB(r) and EDDB(r) functions provide a uniform approach to quantify chemical bonding and resonance, multicenter electron sharing and aromaticity within one theoretical paradigm. There are several important features that set the EDDB method apart from other measures of electron delocalization in aromatic rings:

PL  Download

PL  Recent applications


Global resonance effects in DNA fragment AATTCGTATAAAAACTAGAC visualized by EDDBg(r):







Last update:    2018-01-09