Dariusz W. Szczepanik

K. Guminski Department of Theoretical Chemistry
Faculty of Chemistry, Jagiellonian University
Gronostajowa 2, 30-387 Krakow, Poland
  (+48) 12 379 49 79    live:dszczpnk
  dszczpnk@gmail.com



PL  What is EDDB?

The EDDB method relies on the following decomposition of the one-electron density ED(r):

PL  Features & Capabilities

The EDLB(r) and EDDB(r) functions provide a uniform approach to quantify chemical bonding and resonance, multicenter electron sharing and aromaticity within one theoretical paradigm. There are several important features that set EDDB apart from other aromaticity indices:

At the moment the EDDB method works for one-determinant wavefunctions (HF- and DFT-type) of both closed- and open-shell molecular systems; generalization of the EDDB method for the post-HF wavefunctions is in progress. Its current implementation involves the Hilbert-space partitioning within the representation of natural atomic orbitals (NAO), which is widely available for most of the popular quantum-chemistry packages through NBO and JaNPA interfaces.

PL  Examples

Global resonance effects in DNA fragment AATTCGTATAAAAACTAGAC visualized by EDDBg(r):

PL  Download







Last update:    2018-01-09